Bimolecular fluorescence complementation (BMFC) to investigate protein-protein interactions in planta

• Home
• Project Description
• Data
• Personnel
• Annual Research Progress Reports
• Protocols / Vectors

For additional information about this research, contact:

Dr. Stanton Gelvin gelvin@bilbo.bio.purdue.edu
765/494-4939
Department of Biological Sciences Purdue University 1392 Lilly Hall West Lafayette, IN 47907-1392

This Year 2 Progress Report is Cumulative for the Entire Term of the Grant

Names and Positions of People Hired
Publications
Research Progress
Encountered Problems

A. Names and Positions of People Hired

• Kelly Babb � Technician (female, Caucasian American)
• Darnelle Delva � Undergraduate (female, African American)
• Stanislav Kozlovsky � Postdoc (male, Russia)
• Lan-Ying Lee�Associate Research Scientist (female, Taiwan)
• Songya Lu�Postdoc (female, China)
• Manjusha Vaidya � Technician (female, India)
• Shachi Vyas � Technician (female, India)
• Fenfen Wang � Undergraduate (female, China)
• Zhe Wang � Graduate Student (male, China)
• Esan Wilkinson�Undergraduate (male, African American)
• Zhou Yizhou � Undergraduate (female, China)
• Zhuzhu Zhang � Graduate Student (female, China)

B. Publications using basic/early versions of BiFC constructs

1. 1. Tzfira, T., Vaidya, M., & Citovsky, V. (2004) . Nature 431, 87-92.
   2. Loyter, A., Rosenbluh, J., Zakai, N., Li, J., Kozlovsky, S.V., Tzfira, T., & Citovsky, V. (2005) The plant VirE2 interacting protein 1. A molecular link between the Agrobacterium T-complex and the host cell chromatin? Plant Physiol. 138, 1318-1321.
   3. Lacroix, B., Vaidya, M., Tzfira, T., & Citovsky, V. (2005) The VirE3 protein of Agrobacterium mimics a host cell function required for plant genetic transformation. EMBO J. 24, 428-437.
   4. Li, J., Krichevsky, A., Vaidya, M., Tzfira, T., & Citovsky, V. (2005) Uncoupling of the functions of the Arabidopsis VIP1 protein in transient and stable plant genetic transformation by Agrobacterium. Proc. Natl. Acad. Sci. USA 102, 5733-5738.
   5. Lacroix, B., Tzfira, T., Vainstein, A., & Citovsky, V. (2005) A case of promiscuity: Agrobacterium’s endless search for partners. Trends Genet. 21, in press.
   6. Gelvin, S.B. (2005) Gene exchange by design. Nature 433, 583-584.
   7. Gelvin, S.B. (2005) Viral-mediated plant transformation gets a boost. Nature Biotechnol. 23, 684-685.
   8. Tzfira, T., Tian, G.W., Lacroix, B., Vyas, S., Li, J., Leitner-Dagan, Y., Krichevsky, A., Taylor, T., Vainstein, A., & Citovsky, V. (2005) pSAT vectors: a modular series of plasmids for fluorescent protein tagging and expression of multiple genes in plants. Plant Mol. Biol. 57,
   503-516.
   9. Chung, S.-M., Frankman, E.L., & Tzfira, T. (2005) A versatile vector system for multiple gene expression in plants. Trends Plant Sci. 10, 357-361.

   Publications using current versions of BiFC constructs
   10. Krichevsky, A., Kozlovsky, S.V., Gafni, Y., & Citovsky, V. (2006) Nuclear import and export of plant viral proteins and genomes. Mol. Plant Pathol. 7, 131-146. COVER ARTICLE
   11. Citovsky, V., Lee, L.Y., Vyas, S., Glick, E., Chen, M.H., Vainstein, A., Gafni, Y., Gelvin, S.B., & Tzfira, T. (2006) Identification of subcellular localization of interacting proteins by bimolecular fluorescence complementation in planta. J. Mol. Biol. 362, 1120-1131.
   12. Gelvin, S.B. (2007) Function of host proteins in the Agrobacterium-mediated plant transformation process. In Agrobacterium, from biology to biotechnology (T. Tzfira and V. Citovsky, eds.). Kluwer Academic Publishers, Dordrecht, The Netherlands. In press.
   13. Bhattacharjee, S., Cao, H., Lee, L.-Y., Veena, and Gelvin, S.B. 2006. AtImpa-4, an Arabidopsis importin ? isoform, is preferentially involved in Agrobacterium-mediated plant transformation. Submitted.

C. Research Progress

During the first year of the grant, we performed two lines of concurrent experiments: proof of concept of BiFC in plants using basic, early versions of the vectors, and converting these vectors to the optimized BiFC system described in the original proposal.

• Proof of concept (Citovsky laboratory)
  We prepared simple versions of the BiFC vectors without multiple cloning sites or Gateway cassettes, without peptide linkers for optimal tag folding, and without the capability for stable expression.  We then used these vectors to demonstrate that BiFC can indeed be achieved directly in plant tissues, and that it can be used for detection of protein interaction and subcellular localization of the interacting proteins.
  We initially used four pairs of potential interactors:  H2A-VIP1, VirF-VIP1, VirE2-VIP1, and VirE2-VirE3. Vir proteins were derived from Agrobacterium, whereas H2A and VIP1 were from Arabidopsis .  Our experiments clearly showed specific interactions between these proteins and demonstrated that they occurred within the cell nucleus, the expected location of the biological action of these proteins.  These data were reported in the publications listed separately. 

  We initially used four pairs of potential interactors: H2A-VIP1, VirF-VIP1, VirE2-VIP1, and VirE2-VirE3. Vir proteins were derived from Agrobacterium, whereas H2A and VIP1 were from Arabidopsis . Our experiments clearly showed specific interactions between these proteins and demonstrated that they occurred within the cell nucleus, the expected location of the biological action of these proteins. These data were reported in the publications listed separately.

• Initial vector construction (Citovsky laboratory)
  To facilitate BiFC between cYFP and nYFP fused to proteins of interest, we constructed sets of vectors with ORFs of these YFP fragments flanked with sequences coding for flexible linker peptides; these peptide linkers minimize protein folding interference between the YFP fragment and the tagged protein. These flexible linkers also increase the likelihood of restoration of the proper YFP conformation following interaction.

  For these initial vectors, we split YFP between amino acid residues 153 and 154.  Fragments nEYFP-L1N1, cEYFP-L1N1, nEYFP-L2C1, and cEYFP-L2C1 were PCR-amplified with primers
  
  F-nEYFP-L1N1- BamHI (cgggatcctg ggaggtggaggtggagctatggtgagcaagggcgaggagctg) and
  R-nEYFP-N1- XbaI (gctctagactaggtggatcttcagatatagacgttgtggctgttgtag),
  
  F-cEYFP-L1N1- BamHI (cgggatcctg ggaggtggaggtggagctatggccgacaagcagaagaac) and
  R-cEYFP-N1- XbaI (gctctagactaggtggatcttcacttgtacagctcgtccatgcc),
  
  F-nEYFP-C1- NcoI (catgccatggtgagcaagggcgaggagctgttcacc) and
  R-nEYFP-L2C1- BglII (gaagatctgagtccgga ggccccagcggcagcagcagcaccagcgatatagacgttgtggctgttgtag),
  
  F-cEYFP-C1- NcoI (catgccatgggcgccgacaagcagaagaacggcatc) and R-cEYFP-L2C1- BglII (gaagatctgagtccgga ggccccagcggcagcagcagcaccagccttgtacagc),

  respectively using pSAT6-YFP-C1 as a template. C1 and N1 designate YFP fragments generating fusions to their C- and N- termini, respectively.  L1 and L2 designate sequences (underlined) encoding flexible linkers (Gly) ₅Ala and AlaGly(Ala) ₅GlyAla, connecting the C- and N-termini of tagged protein with the YFP fragment.  YFP fragments nEYFP-L1N1 and cEYFP-L1N1 were cloned as BamHI- XbaI-digested PCR fragments into the same sites of pSAT4-MCS and pSAT1-MCS, generating clones pSAT4-nEYFP153-L1N1 and pSAT1-cEYFP154-L1N1.  Fragments nEYFP-L2C1 and cEYFP-L2C1 were cloned as NcoI- BglII-digested PCR fragments into the same sites of pSAT4-MCS and pSAT1-MCS, generating clones pSAT4-nEYFP153-L2C1 and pSAT1-cEYFP154-L2C1. 
  
  Both BiFC interactors fused to YFP fragments and placed in different pSAT vectors (for example, pSAT1 and pSAT4) can be assembled in a single binary vector (such as pPZP-RCS1 or pPZP-RCS2) for simultaneous expression of both proteins, greatly increasing efficiency of interaction and, as a result, restoration of the YFP fluorescence signal.  To confirm successful delivery of a vector carrying both cassettes into the cell, a free fluorescent protein different from YFP may be used.  Red fluorescent protein RFP (derivate of DsRed) was selected as the reference marker; excitation and emission spectra of YFP and RFP virtually do not overlap, ruling out the possibility of false-positive BiFC signal due to RFP “bleed-over”. 
  
  In some vector configurations, it would be convenient to express RFP marker not as a free protein, but as a fusion protein exhibiting specific intracellular localization (for example, such fusion might be used to confirm specific localization of BiFC-generated YFP signal).  Thus, we constructed two vectors for generating fusions to N- and C- termini of RFP. RFP-N1 and RFP-C1 were PCR-amplified with primers F-RFP-N1- BamHI (cgggatcctgatggcctcctccgaggacg) and R-RFP-N1- XbaI (gctctagattaggcgccggtggagtggcg), F-RFP-C1- NcoI (catgccatggcctccgaggacg) and R-RFP-C1- BglII (gaagatctgagtccggaggcgccggtggagtggcggcc), respectively, using the pRTL2-mRFP plasmid as a template.  RFP-N1 was cloned as a BamHI- XbaI-digested PCR fragment into the same sites of pSAT6-MCS, generating clone pSAT6-RFP-N1. RFP-C1 was cloned as NcoI- BglII digested PCR fragment into the same sites of pSAT6-MCS (RFP ORF has an internal NcoI site, so the RFP-C1 ORF was assembled in pSAT6-MCS sequentially, ( NcoI- XbaI fragment following NcoI- NcoI fragment), generating the plasmid pSAT6-RFP-C1. Both constructs also allow expression of free unfused RFP. 

  
  
• Advanced vector construction (Gelvin laboratory, with the help of Dr. Tzvi Tzfira) While the Citovsky laboratory was establishing proof of concept with basic BiFC vectors, the Gelvin laboratory tested several parameters relating to the use of various YFP "splits" and plant delivery systems.
  
  Most of the published work using BiFC has used "splits" in YFP between amino acids 153 and 154. However, conversations with Dr. Cheng Deng Hu, the inventor of the technique, indicated that splitting YFP at other positions may result in a stronger BiFC signal. We therefore tested, using the same interacting sets of partners, splits between amino acids 174 and 175 as well as the previously used vectors which split YFP between amino acids 153 and 154. The initial interacting partners used were VirD2-importin a, VirE2-VirE2, and VirE2-importin a. Plasmids containing the cYFP fusion and the nYFP fusion were co-electroporated into tobacco BY-2 protoplasts and the cells examined 24 and 48 hours later for YFP fluorescence. Numerous experiments indicated that splitting YFP between amino acids 174 and 175 resulted in a consistently stronger YFP signal than splitting YFP between amino acids 153 and 154. Future vectors, therefore, will incorporate the 174/175 YFP split.
  
  For further development of the BiFC system, we wanted to develop the tobacco BY-2 cell suspension system (this will be useful for screening "prey cDNA libraries" in the future). We noticed that, using this system, the previously-used dsRed protein gave a high background fluorescence in the YFP channel. We attribute this to the well-known slow maturation of this protein. To overcome this problem, we examined monomeric RFP (mRFP) as an alternative autofluorescent protein. This protein matures very quickly, and therefore fluoresces almost exclusively in the RFP channel, and not in the YFP channel. This protein is therefore better suited for use as a "marker" for cells that have been transformed, as well as a fusion protein marker for sub-cellular compartments.
  
  Using this more optimized system, we examined the interaction of Agrobacterium VirD2 protein with four isoforms of Arabidopsis importin ? (AtImpa-1/AtKAP ?, AtImpa-4, AtImpa7, and AtImpa-9). VirD2 interacted strongly with each of these importin ? isoforms and, as expected, the interacting partners localized to the cell nucleus.
  
  We next examined the interaction of Agrobacterium VirE2 protein with itself in electroporated tobacco protoplasts. Somewhat surprisingly, the interaction occurred in the cell cytoplasm. Other experiments, using "extracellular complementation", indicated that the two tagged VirE2 fusions were biologically active to participate in Agrobacterium-mediated transformation. Our results were confirmed by showing that a biologically active form of VirE2 tagged with full-length YFP also localized to the plant cytoplasm in transiently transformed tobacco BY-2 protoplasts, and stably transformed BY-2 cells and transgenic Arabidopsis plants.
  
  We also tested, using BiFC, the interaction of VirE2 with the four importin a isoforms listed above. Co-expression of tagged VirE2 individually with each tagged importin a isoform indicated that in each instance, interaction occurred in the cytoplasm of transiently transfected tobacco BY-2 protoplasts.
  
  Finally, we investigated the interaction of importin- a1 (AtImpa-1) with itself, and importin- a4 (AtImpa-4) with itself in tobacco BY-2 cells transfected by electroporation, and in onion epidermal cells transfected by microprojectile bombardment. In each of these instances, importin a interacted with itself and, as expected, localized to the cell nucleus.
  


• Using BiFC to test cytoskeletal protein interactions (Gelvin and Staiger laboratories)
  To date, no laboratory has been able convincingly to show incorporation of tagged actin protein into plant microfilaments.  This inability may result from disruption of actin polymerization domains by the tag, or from the fact that the majority of cellular actin is in a large G-actin pool which would mask the visualization of small amounts of fluorescence in a polymer pool (F-actin).
  We would like to visualize YFP-tagged actin with itself and with actin-binding proteins in microfilaments.  To that end, we have tagged Arabidopsis ACTIN2 with “half” YFP moieties at either the N- or C-terminus, and will co-introduce these constructions into act2 mutant Arabidopsis plants.  We shall determine whether these tagged actin proteins are functional by complementation of the act2 mutant for restoration of Agrobacterium-mediated transformation (the act2 mutant is resistant to Agrobacterium-mediated transformation, but this defect can be complemented by non-tagged actin).  We shall also determine whether we can visualize actin-actin interactions in microfilaments in planta. 

  During the first year of the grant, we performed two lines of concurrent experiments: proof of concept of BiFC in plants using basic, early versions of the vectors, and converting these vectors to the optimized BiFC system described in the original proposal.
  
  1. Proof of concept (Citovsky laboratory)
  We prepared simple versions of the BiFC vectors without multiple cloning sites or Gateway cassettes, without peptide linkers for optimal tag folding, and without the capability for stable expression.  We then used these vectors to demonstrate that BiFC can indeed be achieved directly in plant tissues, and that it can be used for detection of protein interaction and subcellular localization of the interacting proteins.
  
  We initially used four pairs of potential interactors:  H2A-VIP1, VirF-VIP1, VirE2-VIP1, and VirE2-VirE3. Vir proteins were derived from Agrobacterium, whereas H2A and VIP1 were from Arabidopsis .  Our experiments clearly showed specific interactions between these proteins and demonstrated that they occurred within the cell nucleus, the expected location of the biological action of these proteins.  These data were reported in the publications listed separately. 
  
  2. Initial vector construction (Citovsky laboratory)
  To facilitate BiFC between cYFP and nYFP fused to proteins of interest, we constructed sets of vectors with ORFs of these YFP fragments flanked with sequences coding for flexible linker peptides; these peptide linkers minimize protein folding interference between the YFP fragment and the tagged protein. These flexible linkers also increase the likelihood of restoration of the proper YFP conformation following interaction. For these initial vectors, we split YFP between amino acid residues 153 and 154. Fragments nEYFP-L1N1, cEYFP-L1N1, nEYFP-L2C1, and cEYFP-L2C1 were PCR-amplified with primers
  
  F-nEYFP-L1N1-BamHI (cgggatcctgggaggtggaggtggagctatggtgagcaagggcgaggagctg) and
  R-nEYFP-N1-XbaI (gctctagactaggtggatcttcagatatagacgttgtggctgttgtag),
  
  F-cEYFP-L1N1-BamHI (cgggatcctgggaggtggaggtggagctatggccgacaagcagaagaac) and
  R-cEYFP-N1-XbaI (gctctagactaggtggatcttcacttgtacagctcgtccatgcc),
  
  F-nEYFP-C1-NcoI (catgccatggtgagcaagggcgaggagctgttcacc) and
  R-nEYFP-L2C1-BglII (gaagatctgagtccggaggccccagcggcagcagcagcaccagcgatatagacgttgtggctgttgtag),
  
  F-cEYFP-C1-NcoI (catgccatgggcgccgacaagcagaagaacggcatc) and
  R-cEYFP-L2C1-BglII (gaagatctgagtccggaggccccagcggcagcagcagcaccagccttgtacagc),
  
  respectively using pSAT6-YFP-C1 as a template. C1 and N1 designate YFP fragments generating fusions to their C- and N- termini, respectively. L1 and L2 designate sequences (underlined) encoding flexible linkers (Gly)5Ala and AlaGly(Ala)5GlyAla, connecting the C- and N-termini of tagged protein with the YFP fragment. YFP fragments nEYFP-L1N1 and cEYFP-L1N1 were cloned as BamHI-XbaI-digested PCR fragments into the same sites of pSAT4-MCS and pSAT1-MCS, generating clones pSAT4-nEYFP153-L1N1 and pSAT1-cEYFP154-L1N1. Fragments nEYFP-L2C1 and cEYFP-L2C1 were cloned as NcoI-BglII-digested PCR fragments into the same sites of pSAT4-MCS and pSAT1-MCS, generating clones pSAT4-nEYFP153-L2C1 and pSAT1-cEYFP154-L2C1.
  
  Both BiFC interactors fused to YFP fragments and placed in different pSAT vectors (for example, pSAT1 and pSAT4) can be assembled in a single binary vector (such as pPZP-RCS1 or pPZP-RCS2) for simultaneous expression of both proteins, greatly increasing efficiency of interaction and, as a result, restoration of the YFP fluorescence signal. To confirm successful delivery of a vector carrying both cassettes into the cell, a free fluorescent protein different from YFP may be used. Red fluorescent protein RFP (derivate of DsRed) was selected as the reference marker; excitation and emission spectra of YFP and RFP virtually do not overlap, ruling out the possibility of false-positive BiFC signal due to RFP �bleed-over�.
  
  In some vector configurations, it would be convenient to express RFP marker not as a free protein, but as a fusion protein exhibiting specific intracellular localization (for example, such fusion might be used to confirm specific localization of BiFC-generated YFP signal). Thus, we constructed two vectors for generating fusions to N- and C- termini of RFP. RFP-N1 and RFP-C1 were PCR-amplified with primers
  
  F-RFP-N1-BamHI (cgggatcctgatggcctcctccgaggacg) and
  R-RFP-N1-XbaI (gctctagattaggcgccggtggagtggcg),
  
  F-RFP-C1-NcoI (catgccatggcctccgaggacg) and
  R-RFP-C1-BglII (gaagatctgagtccggaggcgccggtggagtggcggcc),
  
  respectively, using the pRTL2-mRFP plasmid as a template. RFP-N1 was cloned as a BamHI-XbaI-digested PCR fragment into the same sites of pSAT6-MCS, generating clone pSAT6-RFP-N1. RFP-C1 was cloned as NcoI-BglII digested PCR fragment into the same sites of pSAT6-MCS (RFP ORF has an internal NcoI site, so the RFP-C1 ORF was assembled in pSAT6-MCS sequentially, (NcoI-XbaI fragment following NcoI-NcoI fragment), generating the plasmid pSAT6-RFP-C1. Both constructs also allow expression of free unfused RFP.
  
  3. Advanced vector construction (Gelvin laboratory, with the help of Dr. Tzvi Tzfira)
  While the Citovsky laboratory was establishing proof of concept with basic BiFC vectors, the Gelvin laboratory tested several parameters relating to the use of various YFP �splits� and plant delivery systems.
  
  Most of the published work using BiFC has used �splits� in YFP between amino acids 153 and 154. However, conversations with Dr. Cheng Deng Hu, the inventor of the technique, indicated that splitting YFP at other positions may result in a stronger BiFC signal. We therefore tested, using the same interacting sets of partners, splits between amino acids 174 and 175 as well as the previously used vectors which split YFP between amino acids 153 and 154. The initial interacting partners used were VirD2-importin ?, VirE2-VirE2, and VirE2-importin ?. Plasmids containing the cYFP fusion and the nYFP fusion were co-electroporated into tobacco BY-2 protoplasts and the cells examined 24 and 48 hours later for YFP fluorescence. Numerous experiments indicated that splitting YFP between amino acids 174 and 175 resulted in a consistently stronger YFP signal than splitting YFP between amino acids 153 and 154. Future vectors, therefore, will incorporate the 174/175 YFP split.
  
  For further development of the BiFC system, we wanted to develop the tobacco BY-2 cell suspension system (this will be useful for screening �prey cDNA libraries� in the future). We noticed that, using this system, the previously-used dsRed protein gave a high background fluorescence in the YFP channel. We attribute this to the well-known slow maturation of this protein. To overcome this problem, we examined monomeric RFP (mRFP) as an alternative autofluorescent protein. This protein matures very quickly, and therefore fluoresces almost exclusively in the RFP channel, and not in the YFP channel. This protein is therefore better suited for use as a �marker� for cells that have been transformed, as well as a fusion protein marker for sub-cellular compartments.
  
  Using this more optimized system, we examined the interaction of Agrobacterium VirD2 protein with four isoforms of Arabidopsis importin ? (AtImpa-1/AtKAP?, AtImpa-4, AtImpa7, and AtImpa-9). VirD2 interacted strongly with each of these importin ? isoforms and, as expected, the interacting partners localized to the cell nucleus.
  
  We next examined the interaction of Agrobacterium VirE2 protein with itself in electroporated tobacco protoplasts. Somewhat surprisingly, the interaction occurred in the cell cytoplasm. Other experiments, using �extracellular complementation�, indicated that the two tagged VirE2 fusions were biologically active to participate in Agrobacterium-mediated transformation. Our results were confirmed by showing that a biologically active form of VirE2 tagged with full-length YFP also localized to the plant cytoplasm in transiently transformed tobacco BY-2 protoplasts, and stably transformed BY-2 cells and transgenic Arabidopsis plants.
  
  We also tested, using BiFC, the interaction of VirE2 with the four importin ? isoforms listed above. Co-expression of tagged VirE2 individually with each tagged importin ? isoform indicated that in each instance, interaction occurred in the cytoplasm of transiently transfected tobacco BY-2 protoplasts.
  
  Finally, we investigated the interaction of importin-?1 (AtImpa-1) with itself, and importin-?4 (AtImpa-4) with itself in tobacco BY-2 cells transfected by electroporation, and in onion epidermal cells transfected by microprojectile bombardment. In each of these instances, importin ? interacted with itself and, as expected, localized to the cell nucleus.
  
  4. Using BiFC to test cytoskeletal protein interactions (Gelvin and Staiger laboratories)
  To date, no laboratory has been able convincingly to show incorporation of tagged actin protein into plant microfilaments. This inability may result from disruption of actin polymerization domains by the tag, or from the fact that the majority of cellular actin is in a large G-actin pool which would mask the visualization of small amounts of fluorescence in a polymer pool (F-actin). We would like to visualize YFP-tagged actin with itself and with actin-binding proteins in microfilaments. To that end, we have tagged Arabidopsis ACTIN2 with �half� YFP moieties at either the N- or C-terminus, and will co-introduce these constructions into act2 mutant Arabidopsis plants. We shall determine whether these tagged actin proteins are functional by complementation of the act2 mutant for restoration of Agrobacterium-mediated transformation (the act2 mutant is resistant to Agrobacterium-mediated transformation, but this defect can be complemented by non-tagged actin). We shall also determine whether we can visualize actin-actin interactions in microfilaments in planta.
  
  During the second year of the grant, we continued the development of BiFC vectors

  1. Completed vectors (Citovsky lab, with the help of Dr. Tzvi Tzfira):
  We constructed the a large series of vectors as described in the original application. Below are descriptions of the major representatives of the members of this vector family.

  pSAT4A-nEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the N-terminal half of YFP (=nYFP; aa 1-174); when coexpressed w/ fusion of another tested protein to the C-terminal half of YFP (=cYFP; aa 175-end), produces YFP fluorescence if both proteins interact; 2x35S prom.-TL cloned as AgeI-BglII frag. into the same sites of pSAT4-nEYFP-N1 (E1601) instead of AgeI-2x35Sprom.-TL-NcoI-BspEI-BglII; ISceI-AgeI-2x35Sprom.-TL-MCS-nYFP-STOP-XbaI-35SpolyA-NotI-ISceI; MCS: BglII-XhoI-SacI-HindIII-EcoRI-PstI(not unique, nYFP has PstI)-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; pSAT4A is the same as pSAT4 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; expression cassette from this satellite plasmid can be transferred into ISceI of pPZP-RCS-based binary vectors; Acc. No. DQ169003; Amp ^r

  pSAT4A-cEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; 2x35S prom.-TL cloned as AgeI-BglII frag. into the same sites of pSAT4-cEYFP-N1 [pSAT4-cEYFP-N1 (Acc. No. DQ169004) is same as pSAT1-cEYFP-N1 (E1602) but has ISceI sites flanking the expression cassette] instead of AgeI-2x35Sprom.-TL-NcoI-BspEI-BglII; ISceI-AgeI-2x35Sprom.-TL-MCS-cYFP-XbaI-35SpolyA-NotI-ISceI; MCS: BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; pSAT4A is the same as pSAT4 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; expression cassette from this satellite plasmid can be transferred into ISceI of pPZP-RCS-based binary vectors; Acc. No. DQ169002; Amp ^r

  pSAT5-supP-cEYFP-C1-agsT bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of N-terminus of tested protein to C-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; has �super promoter� (cloned as XmaI-NcoI PCR frag.) and agropine synthase terminator (cloned as XbaI-NotI PCR frag.) from pMSP2 (E493, E924); ICeuI-supP-TL-NcoI-cYFP-MCS-XbaI-agsT-NotI-ICeuI; MCS: BspEI-BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-KpnI-SacII-XmaI-ApaI-SmaI-XbaI; addition of NcoI created extra ORF similar in length to YFP that overlaps YFP, but the plasmid expresses cYFP OK; for construct w/o this ORF, see E1768; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; clone Y22B; Amp ^r

  pSAT5-supP-cEYFP-C1(B)-agsT bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of N-terminus of tested protein to C-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; has �super promoter� (cloned as XmaI-NcoI PCR frag.) and agropine synthase terminator (cloned as XbaI-NotI PCR frag.) from pMSP2 (E493, E924); ICeuI-supP.-TL-NcoI-cYFP-MCS-XbaI-agsT-NotI-ICeuI; MCS: BspEI-BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-KpnI-SacII-XmaI-ApaI-SmaI-XbaI; remove extra ORF, which is similar in length to YFP and overlaps YFP, created by addition of NcoI, an extra Gly was added at position 3 in YFP; for construct w/ this extra ORF, see E1767; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; clone Y56B; Amp ^r

  pSAT5-cEYFP-C1(B) bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of N-terminus of tested protein to C-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; cEYFP-C1(B) expression cassette cloned as AgeI-NotI frag. of pSAT1-cEYFP-C1(B) (E1603) into the same sites of pSAT5-ECFP-C1 [pSAT5-ECFP-C1 is same as pSAT6-ECFP-C1 (E1456) but has ICeuI sites flanking the expression cassette] instead of 2x35Sprom-TL-ECFP-MCS-35SpolyA; ICeuI-AgeI-2x35Sprom.-TL-NcoI-cEYFP-MCS-STOP-XbaI-35SpolyA-NotI-ICeuI; MCS: BspEI(not unique, backbone has BspEI)-BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; to remove extra ORF, which is similar in length to cYFP and overlaps cYFP, created by addition of NcoI, an extra Gly was added at position 3 in cYFP; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; Amp ^r

  pSAT5A-cEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; 2x35Sprom.-TL-MCS-cEYFP-35SpolyA cloned as AgeI-NotI frag. of pSAT1A-cEYFP-N1 (E1798) into the same sites of pSAT5-ECFP-C1 [pSAT5-ECFP-C1 is same as pSAT6-ECFP-C1 (E1456) but has ICeuI sites flanking the expression cassette] instead of 2x35Sprom-TL-ECFP-MCS-35SpolyA; ICeuI-AgeI-2x35Sprom.-TL-MCS-cEYFP-XbaI-35SpolyA-NotI-ICeuI; MCS: BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; pSAT5A is the same as pSAT5 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; Amp ^r

  pSAT5-DEST-cEYFP-C1(B) bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of N-terminus of tested protein to C-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; pSAT5-cEYFP-C1(B) (E1788) converted to Gateway Destination Vector by cloning Gateway conversion cassette (reading frame A) as BglII-XbaI frag. of pSAT6-DEST-EGFP-C1 (E1559) into the same sites of pSAT5-cEYFP-C1(B) (E1788) instead of MCS; 2x35Sprom.-TL-cEYFP-attR1-Cmr-ccdB-attR2-35SpolyA cassette flanked by ICeuI rare cutter; ICeuI-AgeI-2x35Sprom.-TL-NcoI-cEYFP-BglII-attR1-NotI-BamHI-BspEI-EcoRI-Cmr-NcoI-BamHI-AccI-XmaI-SmaI-ccdB-PstI-SalI-AccI-attR2-XbaI-35SpolyA-NotI-ICeuI; 5,728 bp; to use Gateway for making fusions to C-terminus of cEYFP for BiFC assay in plants; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; must be grown in DB3.1 E. coli strain (E1208) due to toxicity of ccdB (interferes w/ bacterial gyrase) in most strains; Cmr and ccdB are removed by LR reaction (attL x attR) when insert is transferred from Entry Vector to Destination Vector, thus, must use strains that do not carry gyrA462 or F� episome (which also confers resistance to ccdB) for final clone selection after recombination into this vector; relaxation w/ topoisomerase I of the Destination Vector prior to LR reaction gives better recombination w/ >10 kb Destination Vectors; Cm ^r, Amp ^r

  pSAT5A-DEST-cEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; pSAT5A-cEYFP-N1 (E1789) converted to Gateway Destination Vector by cloning Gateway conversion cassette (reading frame A) as BglII-ApaI frag. of pSAT6-DEST-EGFP-N1 (E1560) into the same sites of pSAT5A-cEYFP-N1 (E1789) instead of MCS; 2x35Sprom.-TL-attR1-Cmr-ccdB-attR2-GFP-35SpolyA cassette flanked by ICeuI rare cutter; ICeuI-AgeI-2x35Sprom.-TL-BglII-attR1-NotI-BamHI-EcoRI-Cmr-NcoI-BamHI-AccI-XmaI-SmaI-ccdB-PstI-SalI-AccI-attR2-XmaI-ApaI-SmaI-BamHI-cEYFP-XbaI-35SpolyA-NotI-ICeuI; 5,743 bp; pSAT5A is the same as pSAT5 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; to use Gateway for making fusions to C-terminus of cEYFP for BiFC assay in plants; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; must be grown in DB3.1 E. coli strain (E1208) due to toxicity of ccdB (interferes w/ bacterial gyrase) in most strains; Cmr and ccdB are removed by LR reaction (attL x attR) when insert is transferred from Entry Vector to Destination Vector, thus, must use strains that do not carry gyrA462 or F� episome (which also confers resistance to ccdB) for final clone selection after recombination into this vector; relaxation w/ topoisomerase I of the Destination Vector prior to LR reaction gives better recombination w/ >10 kb Destination Vectors; has no NcoI site (and its ATG) upstream of DEST, requiring ATG within the cloned gene; Cm ^r, Amp ^r

  pSAT4A-DEST-nEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the N-terminal half of YFP (=nYFP; aa 1-174); when coexpressed w/ fusion of another tested protein to the C-terminal half of YFP (=cYFP; aa 175-end), produces YFP fluorescence if both proteins interact; pSAT4A-nEYFP-N1 (E1692) converted to Gateway Destination Vector by cloning Gateway conversion cassette (reading frame A) as BglII-ApaI frag. of pSAT6-DEST-EGFP-N1 (E1560) into the same sites of pSAT4A-nEYFP-N1 (E1692) instead of MCS; 2x35Sprom.-TL-attR1-Cmr-ccdB-attR2-GFP-35SpolyA cassette flanked by ISceI rare cutter; ISceI-AgeI-2x35Sprom.-TL-BglII-attR1-NotI-BamHI-EcoRI-Cmr-NcoI-BamHI-AccI-XmaI-SmaI-ccdB-PstI(not unique, nYFP has PstI)-SalI-AccI-attR2-XmaI-ApaI-SmaI-BamHI-nEYFP-XbaI-35SpolyA-NotI-ISceI; 6,054 bp; pSAT4A is the same as pSAT4 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; to use Gateway for making fusions to C-terminus of cEYFP for BiFC assay in plants; expression cassette from this satellite plasmid can be transferred into ISceI of pPZP-RCS-based binary vectors; must be grown in DB3.1 E. coli strain (E1208) due to toxicity of ccdB (interferes w/ bacterial gyrase) in most strains; Cmr and ccdB are removed by LR reaction (attL x attR) when insert is transferred from Entry Vector to Destination Vector, thus, must use strains that do not carry gyrA462 or F� episome (which also confers resistance to ccdB) for final clone selection after recombination into this vector; relaxation w/ topoisomerase I of the Destination Vector prior to LR reaction gives better recombination w/ >10 kb Destination Vectors; has no NcoI site (and its ATG) upstream of DEST, requiring ATG within the cloned gene; Cm ^r, Amp ^r

  pSAT4-DEST-nEYFP-C1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of N-terminus of tested protein to C-terminus of the N-terminal half of YFP (=nYFP; aa 1-174); when coexpressed w/ fusion of another tested protein to the C-terminal half of YFP (=cYFP; aa 175-end), produces YFP fluorescence if both proteins interact; pSAT4-nEYFP-C1 (E1533) converted to Gateway Destination Vector by cloning Gateway conversion cassette (reading frame A) as BglII-XbaI frag. of pSAT6-DEST-EGFP-C1 (E1559) into the same sites of pSAT4-nEYFP-C1 (E1533) instead of MCS; 2x35Sprom.-TL-nEYFP-attR1-Cmr-ccdB-attR2-35SpolyA cassette flanked by ISceI rare cutter; ISceI-AgeI-2x35Sprom.-TL-NcoI-nEYFP-BglII-attR1-NotI-BamHI-BspEI-EcoRI-Cmr-NcoI-BamHI-AccI-XmaI-SmaI-ccdB-PstI(not unique, nYFP has PstI)-SalI-AccI-attR2-XbaI-35SpolyA-NotI-ISceI; 6,032 bp; to use Gateway for making fusions to C-terminus of cEYFP for BiFC assay in plants; expression cassette from this satellite plasmid can be transferred into ISceI of pPZP-RCS-based binary vectors; must be grown in DB3.1 E. coli strain (E1208) due to toxicity of ccdB (interferes w/ bacterial gyrase) in most strains; Cmr and ccdB are removed by LR reaction (attL x attR) when insert is transferred from Entry Vector to Destination Vector, thus, must use strains that do not carry gyrA462 or F� episome (which also confers resistance to ccdB) for final clone selection after recombination into this vector; relaxation w/ topoisomerase I of the Destination Vector prior to LR reaction gives better recombination w/ >10 kb Destination Vectors; Cm ^r, Amp ^r

  pSAT1A-nEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the N-terminal half of YFP (=nYFP; aa 1-174); when coexpressed w/ fusion of another tested protein to the C-terminal half of YFP (=cYFP; aa 175-end), produces YFP fluorescence if both proteins interact; 2x35Sprom.-TL-MCS-nYFP-35SpolyA cloned as AgeI-NotI frag. of pSAT4A-nEYFP-N1 (E1691) into the same sites of pAUX3166 (E1310); AscI-AgeI-2x35Sprom.-TL-MCS-nYFP-STOP-XbaI-35SpolyA-NotI-AscI; MCS: BglII-XhoI-SacI-HindIII-EcoRI-PstI(not unique, nYFP has PstI)-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; pSAT1A is the same as pSAT1 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; expression cassette from this satellite plasmid can be transferred into AscI of pPZP-RCS-based binary vectors; Amp ^r

  pSAT1A-cEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in plants; generates fusion of C-terminus of tested protein to N-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; 2x35Sprom.-TL-MCS-cYFP-35SpolyA cloned as AgeI-NotI frag. of pSAT4A-cEYFP-N1 (E1692) into the same sites of pAUX3166 (E1310); AscI-AgeI-2x35Sprom.-TL-MCS-cYFP-XbaI-35SpolyA-NotI-AscI; MCS: BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; pSAT1A is the same as pSAT1 but has no NcoI (and its ATG) at the beginning of MCS, improving expression; expression cassette from this satellite plasmid can be transferred into AscI of pPZP-RCS-based binary vectors; Amp ^r

  pSAT5-cEYFP-C1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in planta; generates fusion of N-terminus of tested protein to C-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; 2x35Sprom.-TL-cYFP-MCS-35SpolyA cloned as AgeI-NotI frag. of pSAT1-cEYFP-C1 (E1535) into the same sites of pSAT5-ECFP-C1 [pSAT5-ECFP-C1 is same as pSAT6-ECFP-C1 (E1456) but has ICeuI sites flanking the expression cassette] instead of the 2x35Sprom.-TL-ECFP-MCS-35SpolyA; ICeuI-AgeI-2x35Sprom.-TL-NcoI-cYFP-MCS-XbaI-35SpolyA-NotI-ICeuI; MCS: BspEI(not unique, backbone has BspEI)-BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-KpnI-SacII-XmaI-ApaI-SmaI-BamHI-XbaI; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; clone X11, Amp ^r

  pSAT5-cEYFP-N1 bimolecular fluorescence complementation (BiFC) vector for protein-protein interaction in planta; generates fusion of C-terminus of tested protein to N-terminus of the C-terminal half of YFP (=cYFP; aa 175-end); when coexpressed w/ fusion of another tested protein to the N-terminal half of YFP (=nYFP; aa 1-174), produces YFP fluorescence if both proteins interact; 2x35Sprom.-TL-MCS-cEYFP-35SpolyA cloned as AgeI-NotI frag. of pSAT1-cEYFP-N1 (E1602) into the same sites of pSAT5-ECFP-C1 [pSAT5-ECFP-C1 is same as pSAT6-ECFP-C1 (E1456) but has ICeuI sites flanking the expression cassette] instead of 2x35Sprom.-TL-ECFP-MCS-35SpolyA; ICeuI-AgeI-2x35Sprom.-TL-MCS-cYFP-XbaI-35SpolyA-NotI-ICeuI; MCS: NcoI-BspEI(not unique, 35Sprom. has BspEI)-BglII-XhoI-SacI-HindIII-EcoRI-PstI-SalI-AccI(not unique, 35Sprom. has AccI)-KpnI-SacII-XmaI-ApaI-SmaI-BamHI; expression cassette from this satellite plasmid can be transferred into ICeuI of pPZP-RCS-based binary vectors; clone X3; Amp ^r

  2. Generation of a full-length Arabidopsis cDNA library in BiFC vectors (Gelvin laboratory, with the help of scientists at Invitrogen):
  We cloned a normalized, full-length Arabidopsis cDNA library (Invitrogen Catalogue #12210-030) into two BiFC destination vectors (E3130 and E3136). These vectors, in a pBlueScript-based background, contain (in order) a CaMV 35S promoter, either a nYFP or cYFP gene fragment (lacking stop codons), a Gateway site, the cDNA library, a Gateway site, and a polyA addition signal. 87% of the clones contain an insert of average size 1.8 kbp. The collection contains 2.88 x 10 ⁶ cfu. These clones can be used a �preys� to screen for interaction with appropriately-tagged bait proteins.

  3. Generation of subcellular reporter protein-mRFP fusions (Gelvin laboratory)
  In order to perform co-localization experiments to examine the subcellular site of protein-protein interaction, we generated (in pSAT6-based vectors) translational fusions of genes encoding proteins of known localization with mRFP. The following table summarizes the characteristics of the marker protein, and whether fusion with mRFP is at the N- or C-terminus:

  Protein	mRFP location	AGI Code	Localization	Reference
  Pex5	C-terminus	At5g56290	Peroxisome	Cutler et al.  (2000)
  Delta-TIP	C-terminus	At3g16240	Tonoplast	Cutler et al.  (2000)
  PIP2A	C-terminus	At3g53420	Plasma membrane	Cutler et al.  (2000)
  PRP2	C-terminus	At2g21140	Cell wall	Fowler et al.  (1999)
  GSR1	C-terminus	At5g37600	cytosol	Peter & Goodman  (1991)
  RabF2a	N-terminus	At5g45130	prevacuole	Preuss et al.  (2004)
  RabG3c	N-terminus	At3g16100	ER	Preuss et al.  (2004)
  RabA4b	N-terminus	At4g39990	Trans-golgi	Preuss et al.  (2004)
  RecA	C-terminus	At1g79050	Chloroplast	Cerutti et al. (1992)
  VirD2	N-terminus	Ti-plasmid pTiA6	Nucleus	Gelvin lab
  CoxIV	C-terminus	From yeast	Mitochondria	Maarse et al.  (1984)

  We have tested most of the fusion protein markers in electroporated tobacco BY-2 cells, and have initiated generation of transgenic Arabidopsis plants containing these reporter constructs.

  4. Generation of vectors for multi-color BiFC (Gelvin laboratory): Previous work in the laboratory of Cheng-Deng Hu indicated that a bait protein, if appropriately tagged with a cGFP derivative, could be used to interact simultaneously with two prey proteins each tagged with a different nGFP derivative (Hu, C.-D., and Kerpppola, T.K. 2003. Nature Biotechnol. 21: 539-545). These authors noted that strongest fluorescence was generated using cCFP with either nVenus (yellow fluorescence) or nCerulean (blue fluorescence). They also noted that fluorescence was strongest if the various portions (N- or C-termini of the GFP derivative) were generated such that an �overlap� of peptide sequences could occur. Thus, the N-terminal fragments contained the first 174 amino acids, whereas the C-terminal fragments contained amino acids 153 to the end of the protein.

  We adapted this technology to make a series of multi-color BiFC vectors. These are all in various pSAT vectors, containing a CaMV 35S promoter and polyA addition signal flanking the n/cGFP derivative, with multiple cloning sites to make either N- or C-terminal fusions:

  pSAT1-cCFP-C1
  pSAT1-cCFP-N1
  pSAT4-nVenus-N1
  pSAT6-nCerulean-N1
  

  These vectors are currently being tested with VirD2 and VirE2 as baits, and importin ?1 and importin ?4 as simultaneous preys.

  5. Testing BiFC vectors (Gelvin laboratory) We have extensively tested the BiFC vectors in electroporated tobacco BY-2 cells. The following interacting partners yielded strong fluorescence signals:

  Interacting Proteins	Subcellular location of interaction
  VirE2 + VirE2	Cytoplasm
  VirE2 + various importin alpha’s (AtImpa1,4,7,9)	Cytoplasm
  VirD2 + various importin alpha’s (AtImpa1,4,7,9)	Nucleus
  Various importin alpha’s with themselves or with each other (AtImpa1,4)	Nucleus
  VirE1 + VirE2	Cytoplasm
  VIP1 + VIP1	Nucleus
  VirE2 + VIP1	Cytoplasm
  VirD2 + VIP1	Nucleus
  VIP1 + Importin alpha 1	Primarily cytoplasm, some nucleus
  VIP1 + VirE1	Nucleus and cytoplasm

  In addition, we have generated a construction containing a genomic copy of importin alpha-4 tagged at its C-terminus with cYFP (this construction contains the native promoter, all exons and introns, and the 3� UTR region). When co-electroporated into tobacco BY-2 protoplasts with nYFP-VirD2 or VirE2-nYFP, the proteins interacted and localized to the same site (VirD2 + AtImpa-4, nucleus; VirE2 + AtImpa-4, cytoplasm) as when AtImpa-4 was under CaMV 35S promoter control. We have recently stably transformed tobacco BY-2 cells and Arabidopsis plants with constructs expressing AtImpa-4-cYFP. We are currently generating a construction containing full-length genomic VIP1-cYFP under native promoter control.

D. Encountered Problems

We have found that in electroporated tobacco BY-2 protoplasts, signal from  slowly maturing dsRed protein gives significant fluorescence in the YFP channel.  We have overcome this problem by using mRFP instead of dsRed. 

This work is made possible by a grant from the National Science Foundation's Arabidopsis 2010 Research Program